Current Build

Переводит команда Health Samurai. Приглашаем поучаствовать в русификации стандарта FHIR: GitHub, Email.

Diagnosticreport-hla-genetics-results-example.xml

Orders and Observations Work GroupMaturity Level: N/ABallot Status: InformativeCompartments: Device, Encounter, Patient, Practitioner

Raw XML (каноническая форма + also see XML Format Specification)

An example of a HLA genotyping results report (id = "hla-1")

<?xml version="1.0" encoding="UTF-8"?>

<Bundle xmlns="http://hl7.org/fhir">
  <id value="hla-1"/> 
  <type value="transaction"/> 
  <entry> 
    <fullUrl value="urn:uuid:b0a4b18e-94e7-4b1b-8031-c7ae4bdd8db9"/> 
    <resource> 
      <DiagnosticReport> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <h3> HLA-A,-B,-C genotyping report for Mary Chalmers (MRN:12345)</h3> 
            <pre> 
  LOCUS   ALLELE 1            ALLELE 2
  HLA-A   HLA-A:01:01G        HLA-A*01:02
  HLA-B   HLA-B*15:01:01G     HLA-B*57:01:01G
  HLA-C   HLA-C*01:02:01G     HLA-C*03:04:01G
                </pre> 
            <p> Allele assignments based on IMGT/HLA 3.23</p> 
            <p> Effective date: 2015-12-15</p> 
            <p> Method: Sequencing of exons 2 and 3 of HLA Class I genes</p> 
            <p> Lab: aTypingLab Inc</p> 
            <p> Note: Please refer the <a href="genomics.html#hla">implementation guide </a>  for more explanation on this
                carefully organized bundle example.</p> 
            <pre> 
  Bob Milius - NMDP - 2016-12-01

  Transaction bundle that creates and links:
  + DiagnosticReport summarizing genotyping for HLA-A,-B,-C typing of patient(donor)
  + Obervations for each genotype
  + Observations for each allele
  + Sequences for exons 2 and 3 for HLA-A,-B, -C

  The endpoints of the following resources are hardcoded into this transaction bundle
  because these are presumed to already exist when developing the DiagnosticRequest
  which was to generate this report bundle:

  Patient/119 (potential donor)
  Specimen/120 (buccal swab)
  Organization/68  (typing lab)
  ServiceRequest/123  (report is based on this request)
                </pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-allele-database">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
            </coding> 
            <text value="IMGT/HLA 3.23"/> 
          </valueCodeableConcept> 
        </extension> 
        <extension url="http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-glstring">
          <extension url="text">
            <valueString value="HLA-A:01:01G+HLA-A*01:02^HLA-B*15:01:01:01+HLA-B*57:01:01^HLA-C*01:02:01+HLA-C*03:04:01:01"/> 
          </extension> 
          <extension url="uri">
            <valueUri value="https://gl.nmdp.org/imgt-hla/3.23.0/multilocus-unphased-genotype/i"/> 
          </extension> 
        </extension> 
        <extension url="http://hl7.org/fhir/StructureDefinition/hla-genotyping-results-method">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.ncbi.nlm.nih.gov/gtr/"/> 
              <code value="GTR000000000.0"/> 
            </coding> 
            <text value="Next Generation Sequencing of exons 2 and 3 of HLA Class I genes"/> 
          </valueCodeableConcept> 
        </extension> <!--  
          Latest specification no longer contains DiagnosticRequest resources
          The SPEC uses ServiceRequest instead to provide a record of a request
          for a diagnostic investigation.

          Although I only change the link here, there are lots of things that need to
          change in the original example of the original DiagnosticRequest (TODO)
          --><basedOn> 
          <reference value="ServiceRequest/123"/> 
        </basedOn> 
        <status value="final"/> 
        <category> 
          <coding> 
            <system value="http://terminology.hl7.org/CodeSystem/v2-0074"/> 
            <code value="GE"/> 
            <display value="Genetics"/> 
          </coding> 
        </category> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="13303-3"/> 
            <display value="HLA-A+​B+​C (class I) [Type]"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <issued value="2016-12-15T14:15:30-06:00"/> 
        <performer> 
          <reference value="Organization/68"/> 
          <display value="aTypingLab Inc"/> 
        </performer> 
        <specimen> 
          <reference value="Specimen/67"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <result> 
          <reference value="urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228"/> 
          <display value="HLA-A: HLA-A:01:01G+HLA-A*01:02"/> 
        </result> 
        <result> 
          <reference value="urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70"/> 
          <display value="HLA-B: HLA-B*15:01:01G+HLA-B*57:01:01G"/> 
        </result> 
        <result> 
          <reference value="urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208"/> 
          <display value="HLA-C: HLA-C*01:02:01G+HLA-C*03:04:01G"/> 
        </result> 
      </DiagnosticReport> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="DiagnosticReport"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-A*01:01:01:01, exon 2&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00001"/> 
            </coding> 
            <text value="HLA-A*01:01:01:01"/> 
          </referenceSeqId> 
          <windowStart value="503"/> 
          <windowEnd value="773"/> 
        </referenceSeq> 
        <observedSeq value="GCTCCCACTCCATGAGGTATTTCTTCACATCCGTGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCCGTGGGCTACGTGGACGACACGCAGTTCGT
        GCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGA
        AGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-A*01:01:01:01, exon 3&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00001"/> 
            </coding> 
            <text value="HLA-A*01:01:01:01"/> 
          </referenceSeqId> 
          <windowStart value="1014"/> 
          <windowEnd value="1290"/> 
        </referenceSeq> 
        <observedSeq value="GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACAT
        CGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAG
        TCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-A*01:02, exon 2&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00002"/> 
            </coding> 
            <text value="HLA-A*01:02"/> 
          </referenceSeqId> 
          <windowStart value="503"/> 
          <windowEnd value="773"/> 
        </referenceSeq> 
        <observedSeq value="GCTCCCACTCCATGAGGTATTTCTCCACATCCGTGTCCCGGCCCGGCAGTGGAGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGT
        GCGGTTCGACAGCGACGCCGCGAGCCAGAAGATGGAGCCGCGGGCGCCGTGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCAGGAGACACGGAATATGA
        AGGCCCACTCACAGACTGACCGAGCGAACCTGGGGACCCTGCGCGGCTACTACAACCAGAGCGAGGACG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-A*01:02, exon 3&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00002"/> 
            </coding> 
            <text value="HLA-A*01:02"/> 
          </referenceSeqId> 
          <windowStart value="1014"/> 
          <windowEnd value="1290"/> 
        </referenceSeq> 
        <observedSeq value="GTTCTCACACCATCCAGATAATGTATGGCTGCGACGTGGGGCCGGACGGGCGCTTCCTCCGCGGGTACCGGCAGGACGCCTACGACGGCAAGGATTACAT
        CGCCCTGAACGAGGACCTGCGCTCTTGGACCGCGGCGGACATGGCAGCTCAGATCACCAAGCGCAAGTGGGAGGCGGTCCATGCGGCGGAGCAGCGGAGAG
        TCTACCTGGAGGGCCGGTGCGTGGACGGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCACGG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-B*15:01:01:01, exon 2&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00162"/> 
            </coding> 
            <text value="HLA-B*15:01:01:01"/> 
          </referenceSeqId> 
          <windowStart value="486"/> 
          <windowEnd value="756"/> 
        </referenceSeq> 
        <observedSeq value="GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGT
        GAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGATCTCCA
        AGACCAACACACAGACTTACCGAGAGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-B*15:01:01:01, exon 3&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00162"/> 
            </coding> 
            <text value="HLA-B*15:01:01:01"/> 
          </referenceSeqId> 
          <windowStart value="1001"/> 
          <windowEnd value="1277"/> 
        </referenceSeq> 
        <observedSeq value="GGTCTCACACCCTCCAGAGGATGTACGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACAT
        CGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGTGGAGAG
        CCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-B*57:01:01, exon 2&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00381"/> 
            </coding> 
            <text value="HLA-B*57:01:01"/> 
          </referenceSeqId> 
          <windowStart value="485"/> 
          <windowEnd value="755"/> 
        </referenceSeq> 
        <observedSeq value="GCTCCCACTCCATGAGGTATTTCTACACCGCCATGTCCCGGCCCGGCCGCGGGGAGCCCCGCTTCATCGCAGTGGGCTACGTGGACGACACCCAGTTCGT
        GAGGTTCGACAGCGACGCCGCGAGTCCGAGGATGGCGCCCCGGGCGCCATGGATAGAGCAGGAGGGGCCGGAGTATTGGGACGGGGAGACACGGAACATGA
        AGGCCTCCGCGCAGACTTACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAGAGCGAGGCCG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:db69e549-6267-4777-b4b9-8813f3329309"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-B*57:01:01, exon 3&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00381"/> 
            </coding> 
            <text value="HLA-B*57:01:01"/> 
          </referenceSeqId> 
          <windowStart value="1001"/> 
          <windowEnd value="1277"/> 
        </referenceSeq> 
        <observedSeq value="GGTCTCACATCATCCAGGTGATGTATGGCTGCGACGTGGGGCCGGACGGGCGCCTCCTCCGCGGGCATGACCAGTCCGCCTACGACGGCAAGGATTACAT
        CGCCCTGAACGAGGACCTGAGCTCCTGGACCGCGGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGTGGCGGAGCAGCTGAGAG
        CCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-C*01:02:01, exon 2&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00401"/> 
            </coding> 
            <text value="HLA-C*01:02:01"/> 
          </referenceSeqId> 
          <windowStart value="486"/> 
          <windowEnd value="756"/> 
        </referenceSeq> 
        <observedSeq value="GCTCCCACTCCATGAAGTATTTCTTCACATCCGTGTCCCGGCCTGGCCGCGGAGAGCCCCGCTTCATCTCAGTGGGCTACGTGGACGACACGCAGTTCGT
        GCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACA
        AGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-C*01:02:01, exon 3&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00401"/> 
            </coding> 
            <text value="HLA-C*01:02:01"/> 
          </referenceSeqId> 
          <windowStart value="1002"/> 
          <windowEnd value="1278"/> 
        </referenceSeq> 
        <observedSeq value="GGTCTCACACCCTCCAGTGGATGTGTGGCTGCGACCTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACAT
        CGCCCTGAACGAGGACCTGCGCTCCTGGACCGCCGCGGACACCGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAG
        CCTACCTGGAGGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGAGACGCTGCAGCGCGCGG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-C*03:04:01:01, exon 2&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00413"/> 
            </coding> 
            <text value="HLA-C*03:04:01:01"/> 
          </referenceSeqId> 
          <windowStart value="486"/> 
          <windowEnd value="756"/> 
        </referenceSeq> 
        <observedSeq value="GCTCCCACTCCATGAGGTATTTCTACACCGCTGTGTCCCGGCCCGGCCGCGGGGAGCCCCACTTCATCGCAGTGGGCTACGTGGACGACACGCAGTTCGT
        GCGGTTCGACAGCGACGCCGCGAGTCCGAGAGGGGAGCCGCGGGCGCCGTGGGTGGAGCAGGAGGGGCCGGAGTATTGGGACCGGGAGACACAGAAGTACA
        AGCGCCAGGCACAGACTGACCGAGTGAGCCTGCGGAACCTGCGCGGCTACTACAACCAGAGCGAGGCCG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9"/> 
    <resource> 
      <MolecularSequence> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> &quot;HLA-C*03:04:01:01, exon 3&quot;</pre> 
          </div> 
        </text> 
        <type value="dna"/> 
        <coordinateSystem value="0"/> 
        <patient> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </patient> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <referenceSeq> 
          <referenceSeqId> 
            <coding> 
              <system value="http://www.ebi.ac.uk/ipd/imgt/hla"/> 
              <version value="3.23"/> 
              <code value="HLA00413"/> 
            </coding> 
            <text value="HLA-C*03:04:01:01"/> 
          </referenceSeqId> 
          <windowStart value="1001"/> 
          <windowEnd value="1277"/> 
        </referenceSeq> 
        <observedSeq value="GGTCTCACATCATCCAGAGGATGTATGGCTGCGACGTGGGGCCCGACGGGCGCCTCCTCCGCGGGTATGACCAGTACGCCTACGACGGCAAGGATTACAT
        CGCCCTGAACGAGGATCTGCGCTCCTGGACCGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCTGAGAG
        CCTACCTGGAGGGCCTGTGCGTGGAGTGGCTCCGCAGATACCTGAAGAATGGGAAGGAGACGCTGCAGCGCGCGG"/> 
      </MolecularSequence> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="MolecularSequence"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6"/> 
    <resource> 
      <Observation> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> HLA-A:01:01:01G</pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGene">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.genenames.org"/> 
              <code value="HGNC:4931"/> 
              <display value="HLA-A"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsAlleleName">
          <valueCodeableConcept>
            <coding>
              <system value="http://www.ebi.ac.uk/cgi-bin/ipd/imgt/hla/"/>
              <code value="A*01:01:01:01"/>
              <display value="HLA-A*01:01:01G"/>
            </coding>
          </valueCodeableConcept>
        </extension  --><extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://loinc.org"/> 
              <code value="LA6683-2"/> 
              <display value="germline"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsPhaseSet">
          <valueUri value="urn:uuid:e13f147e-41e5-4f7a-b20a-1b52b236c5ba"/>
        </extension  --><status value="final"/> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="57290-9"/> 
            <display value="HLA-A [Type] by High resolution"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <derivedFrom> 
          <reference value="urn:uuid:8200dab6-18a2-4550-b913-a7db480c0804"/> 
          <display value="HLA-A*01:01:01:01, exon 2"/> 
        </derivedFrom> 
        <derivedFrom> 
          <reference value="urn:uuid:7c393185-f15c-45bc-a714-c0fdbea32675"/> 
          <display value="HLA-A*01:01:01:01, exon 3"/> 
        </derivedFrom> 
      </Observation> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="Observation"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32"/> 
    <resource> 
      <Observation> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> HLA-A*01:02</pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGene">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.genenames.org"/> 
              <code value="HGNC:4931"/> 
              <display value="HLA-A"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsAlleleName">
          <valueCodeableConcept>
            <coding>
              <system value="http://www.ebi.ac.uk/cgi-bin/ipd/imgt/hla/"/>
              <code value="A*01:02"/>
              <display value="HLA-A*01:02"/>
            </coding>
          </valueCodeableConcept>
        </extension  --><extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://loinc.org"/> 
              <code value="LA6683-2"/> 
              <display value="germline"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsPhaseSet">
          <valueUri value="urn:uuid:af8e79ec-343e-4380-ba65-cec5266dc2d5"/>
        </extension  --><status value="final"/> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="57290-9"/> 
            <display value="HLA-A [Type] by High resolution"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <derivedFrom> 
          <reference value="urn:uuid:65c85f14-c3a0-4b72-818f-820e04fcc621"/> 
          <display value="HLA-A*01:02, exon 2"/> 
        </derivedFrom> 
        <derivedFrom> 
          <reference value="urn:uuid:fbba9fe7-0ece-4ec1-9233-a437a8d242a0"/> 
          <display value="HLA-A*01:02, exon 3"/> 
        </derivedFrom> 
      </Observation> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="Observation"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:49a86246-4004-42eb-9bdc-f542f93f9228"/> 
    <resource> 
      <Observation> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> HLA-A:01:01G+HLA-A*01:02</pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGene">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.genenames.org"/> 
              <code value="HGNC:4931"/> 
              <display value="HLA-A"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://loinc.org"/> 
              <code value="LA6683-2"/> 
              <display value="germline"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> 
        <status value="final"/> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="57290-9"/> 
            <display value="HLA-A [Type] by High resolution"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <derivedFrom> 
          <reference value="urn:uuid:b7765bbf-df40-486a-9f2f-404309643de6"/> 
          <display value="HLA-A*01:01:01G, exons 2 and 3"/> 
        </derivedFrom> 
        <derivedFrom> 
          <reference value="urn:uuid:d98d92a7-0e86-4ae5-b036-b7e1bba6ec32"/> 
          <display value="HLA-A*01:02, exons 2 and 3"/> 
        </derivedFrom> 
      </Observation> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="Observation"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a"/> 
    <resource> 
      <Observation> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> HLA-B*15:01:01G</pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGene">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.genenames.org"/> 
              <code value="HGNC:4932"/> 
              <display value="HLA-B"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsAlleleName">
          <valueCodeableConcept>
            <coding>
              <system value="http://www.ebi.ac.uk/cgi-bin/ipd/imgt/hla/"/>
              <code value="B*15:01:01:01"/>
              <display value="HLA-B*15:01:01G"/>
            </coding>
          </valueCodeableConcept>
        </extension  --><extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://loinc.org"/> 
              <code value="LA6683-2"/> 
              <display value="germline"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsPhaseSet">
          <valueUri value="urn:uuid:29c67a1b-aeaa-4599-ae20-04b947ef73d8"/>
        </extension  --><status value="final"/> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="57291-7"/> 
            <display value="HLA-B [Type] by High resolution"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <derivedFrom> 
          <reference value="urn:uuid:cbabf93e-1b4b-46f2-ba1e-d84862670670"/> 
          <display value="HLA-B*15:01:01:01, exon 2"/> 
        </derivedFrom> 
        <derivedFrom> 
          <reference value="urn:uuid:c233ad3d-1572-48d6-93da-0a583535e138"/> 
          <display value="HLA-B*15:01:01:01, exon 3"/> 
        </derivedFrom> 
      </Observation> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="Observation"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5"/> 
    <resource> 
      <Observation> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> HLA-B*57:01:01G</pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGene">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.genenames.org"/> 
              <code value="HGNC:4932"/> 
              <display value="HLA-B"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsAlleleName">
          <valueCodeableConcept>
            <coding>
              <system value="http://www.ebi.ac.uk/cgi-bin/ipd/imgt/hla/"/>
              <code value="B*57:01:01"/>
              <display value="HLA-B*57:01:01G"/>
            </coding>
          </valueCodeableConcept>
        </extension  --><extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://loinc.org"/> 
              <code value="LA6683-2"/> 
              <display value="germline"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsPhaseSet">
          <valueUri value="urn:uuid:a19a3557-b36c-4b35-ab8b-4783022066b9"/>
        </extension  --><status value="final"/> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="57291-7"/> 
            <display value="HLA-B [Type] by High resolution"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <derivedFrom> 
          <reference value="urn:uuid:05fa52d7-5c67-460a-8722-d3460b24d6fe"/> 
          <display value="HLA-B*57:01:01, exon 2"/> 
        </derivedFrom> 
        <derivedFrom> 
          <reference value="urn:uuid:db69e549-6267-4777-b4b9-8813f3329309"/> 
          <display value="HLA-B*57:01:01, exon 3"/> 
        </derivedFrom> 
      </Observation> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="Observation"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:60613a43-c4cb-4502-b3e2-cf9215feaa70"/> 
    <resource> 
      <Observation> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> HLA-B*15:01:01G+HLA-B*57:01:01G</pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGene">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.genenames.org"/> 
              <code value="HGNC:4932"/> 
              <display value="HLA-B"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://loinc.org"/> 
              <code value="LA6683-2"/> 
              <display value="germline"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> 
        <status value="final"/> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="57291-7"/> 
            <display value="HLA-B [Type] by High resolution"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <derivedFrom> 
          <reference value="urn:uuid:e2092243-2970-49d2-a90f-b90d1d49715a"/> 
          <display value="HLA-B*15:01:01G, exons 2 and 3"/> 
        </derivedFrom> 
        <derivedFrom> 
          <reference value="urn:uuid:792be53e-d4fb-4887-a367-815ef6c706e5"/> 
          <display value="HLA-B*57:01:01G, exons 2 and 3"/> 
        </derivedFrom> 
      </Observation> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="Observation"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:709c5315-9403-4867-9d82-0b953836665f"/> 
    <resource> 
      <Observation> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> HLA-C*01:02:01</pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGene">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.genenames.org"/> 
              <code value="HGNC:4933"/> 
              <display value="HLA-C"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsAlleleName">
          <valueCodeableConcept>
            <coding>
              <system value="http://www.ebi.ac.uk/cgi-bin/ipd/imgt/hla/"/>
              <code value="C*01:02:01"/>
              <display value="HLA-C*01:02:01"/>
            </coding>
          </valueCodeableConcept>
        </extension  --><extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://loinc.org"/> 
              <code value="LA6683-2"/> 
              <display value="germline"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsPhaseSet">
          <valueUri value="urn:uuid:79383455-4f55-4126-bcc2-03385cad7944"/>
        </extension  --><status value="final"/> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="77636-9"/> 
            <display value="HLA-C [Type] by High resolution"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <derivedFrom> 
          <reference value="urn:uuid:bb55c2bc-5ad2-4bc1-8ff3-c407d06b12d0"/> 
          <display value="HLA-C*01:02:01, exon 2"/> 
        </derivedFrom> 
        <derivedFrom> 
          <reference value="urn:uuid:46938bb2-0486-4e87-bfd3-89aab2d5e22f"/> 
          <display value="HLA-C*01:02:01, exon 3"/> 
        </derivedFrom> 
      </Observation> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="Observation"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47"/> 
    <resource> 
      <Observation> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> HLA-C*03:04:01:01</pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGene">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.genenames.org"/> 
              <code value="HGNC:4933"/> 
              <display value="HLA-C"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsAlleleName">
          <valueCodeableConcept>
            <coding>
              <system value="http://www.ebi.ac.uk/cgi-bin/ipd/imgt/hla/"/>
              <code value="C*03:04:01:01"/>
              <display value="HLA-C*03:04:01:01"/>
            </coding>
          </valueCodeableConcept>
        </extension  --><extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://loinc.org"/> 
              <code value="LA6683-2"/> 
              <display value="germline"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> <!--  extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsPhaseSet">
          <valueUri value="urn:uuid:a220b7a5-2d7a-4cec-a5b1-bfcf5890e391"/>
        </extension  --><status value="final"/> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="77636-9"/> 
            <display value="HLA-C [Type] by High resolution"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <derivedFrom> 
          <reference value="urn:uuid:2ae2ff34-279e-43c2-9018-b054fd3fc1ce"/> 
          <display value="HLA-C*03:04:01:01, exon 2"/> 
        </derivedFrom> 
        <derivedFrom> 
          <reference value="urn:uuid:19153ef1-68c6-47a2-9676-c4eefbd39af9"/> 
          <display value="HLA-C*03:04:01:01, exon 3"/> 
        </derivedFrom> 
      </Observation> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="Observation"/> 
    </request> 
  </entry> 
  <entry> 
    <fullUrl value="urn:uuid:0e0a780e-4486-4cd0-bfae-7243c579f208"/> 
    <resource> 
      <Observation> 
        <text> 
          <status value="generated"/> 
          <div xmlns="http://www.w3.org/1999/xhtml">
            <pre> HLA-C*01:02:01G+HLA-C*03:04:01G</pre> 
          </div> 
        </text> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGene">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://www.genenames.org"/> 
              <code value="HGNC:4933"/> 
              <display value="HLA-C"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> 
        <extension url="http://hl7.org/fhir/StructureDefinition/observation-geneticsGenomicSourceClass">
          <valueCodeableConcept> 
            <coding> 
              <system value="http://loinc.org"/> 
              <code value="LA6683-2"/> 
              <display value="germline"/> 
            </coding> 
          </valueCodeableConcept> 
        </extension> 
        <status value="final"/> 
        <code> 
          <coding> 
            <system value="http://loinc.org"/> 
            <code value="77636-9"/> 
            <display value="HLA-C [Type] by High resolution"/> 
          </coding> 
        </code> 
        <subject> 
          <reference value="Patient/119"/> 
          <display value="Mary Chalmers"/> 
        </subject> 
        <effectiveDateTime value="2016-12-15"/> 
        <specimen> 
          <reference value="Specimen/120"/> 
          <display value="buccal swab from Mary Chalmers"/> 
        </specimen> 
        <derivedFrom> 
          <reference value="urn:uuid:709c5315-9403-4867-9d82-0b953836665f"/> 
          <display value="HLA-C*01:02:01G, exons 2 and 3"/> 
        </derivedFrom> 
        <derivedFrom> 
          <reference value="urn:uuid:8b2aa21c-1426-4717-8ab0-a84d83df7d47"/> 
          <display value="HLA-C*03:04:01G, exons 2 and 3"/> 
        </derivedFrom> 
      </Observation> 
    </resource> 
    <!--      transaction details      -->
    <request> 
      <method value="POST"/> 
      <url value="Observation"/> 
    </request> 
  </entry> 
</Bundle> 

Примечание к использованию: мы очень стараемся приводить корректные и полезные примеры, но нормативно они не являются частью спецификации.