Current Build

Переводит команда Health Samurai. Приглашаем поучаствовать в русификации стандарта FHIR: GitHub, Email.

Sequence-complex-variant

Clinical Genomics Work GroupMaturity Level: N/ABallot Status: InformativeCompartments: Patient

Это описательная часть ресурса. См. также в формате XML, JSON или Turtle. This example conforms to the profile MolecularSequence.


Generated Narrative with Details

id: sequence-complex-variant

identifier: ?? (OFFICIAL)

type: dna

coordinateSystem: 1

specimen: Molecular Specimen ID: MLD45-Z4-1234

device: 12 lead EKG Device Metric

performer: HL7

quantity: 25

ReferenceSeqs

-ReferenceSeqIdStrandWindowStartWindowEnd
*NC_000002.12 (Details : {http://www.ncbi.nlm.nih.gov/nuccore code 'NC_000002.12' = 'NC_000002.12)watson128273724128273754

Variants

-StartEndObservedAlleleReferenceAlleleCigar
*128273724128273736CTCATTGTCTCCATTGCATGCGTT3M1D4M6N2M

readCoverage: 1

Repositories

-TypeDatasetIdReadsetId
*otherEnsemblv1beta2

 

 

Примечание к использованию: мы очень стараемся приводить корректные и полезные примеры, но нормативно они не являются частью спецификации.